Advion Tiversa Nanomate Manual High School
Tryptic peptides were extracted from the gel using 60% acetonitrile and 0.2% TFA. After evaporation, samples were desalted and concentrated with a C18 ZipTip (Millipore) and analyzed with a nanoLC-ESI-MS/MS (Ultimate Plus nano-HPLC system, LTQ, Thermo) interfaced with a TriVersa NanoMate nanoelectrospray ionization source (Advion BioSciences).
AbstractThe small GTPase ADP ribosylation factor 6 (ARF6) mediates endocytosis and has in addition been shown to regulate neuron differentiation. Here we investigated whether ARF6 promotes differentiation of Neuro-2a neuronal cells by modifying the cellular lipid composition.
We showed that knockdown of ARF6 by siRNA in Neuro-2a cells increased neuronal outgrowth as expected. ARF6 knockdown also resulted in increased glucosylceramide levels and decreased sphingomyelin levels, but did not affect the levels of ceramide or phospholipids.
We speculated that the ARF6 knockdown-induced increase in glucosylceramide was caused by an effect on glucosylceramide synthase and, in agreement, showed that ARF6 knockdown increased the mRNA levels and activity of glucosylceramide synthase. Finally, we showed that incubation of Neuro-2a cells with the glucosylceramide synthase inhibitor D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propanol (D-PDMP) normalized the increased neuronal outgrowth induced by ARF6 knockdown. Our results thus show that ARF6 regulates neuronal differentiation through an effect on glucosylceramide synthase and glucosylceramide levels. IntroductionNeuron development and differentiation are complex processes that involve dynamic cell morphology changes. It has been suggested that endosomal trafficking is crucial for actin cytoskeleton structure and neuronal cell differentiation. One well-known regulator of endosomal trafficking is the small GTPase ADP ribosylation factor 6 (ARF6), which localizes to the plasma membrane and endosomal compartments,. In addition, ARF6 has been shown to play important roles in the regulation of actin cytoskeleton and neuronal extension and branching,.
However, the link between ARF6-dependent endocytosis and neuron differentiation remains unclear.Endocytosis is also regulated by modulation of the lipid composition of cellular membranes,. Alterations in lipid composition provide a possible mechanism for regulating endosomal cargo entry, as some proteins associate preferentially with certain types of lipids, such as sphingolipids, phospholipids and cholesterol. Interestingly, ARF6 has been shown to regulate signaling of bioactive lipids in the plasma membrane,.In this study, we investigated whether ARF6-dependent neuron differentiation is regulated by alterations in lipid composition.
We found that ARF6 knockdown resulted in increased glucosylceramide content and glucosylceramide synthase activity in Neuro-2a neuronal cells. Furthermore, we found that ARF6-dependent neuron differentiation is regulated by the altered glucosylceramide synthase activity in neuronal cells. RT-PCR expression analysesTotal RNA was extracted with an RNeasy Kit (QIAGEN, Hilden, Germany), and cDNA was synthesized with the high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). MRNA expression of genes of interest was analyzed with TaqMan real-time polymerase chain reaction in an ABI Prism 7900 HT Detection System (Applied Biosystems) and normalized to β-actin. The following TaqMan Gene Expression assays from Applied Biosystems were used: GCS (Ugcg) Mm00495925m1, beta-Actin Mm01205647g1, NeuroD1 Mm01946604s1, Rbfox3 Mm01248771m1 and 36B4 Mm007725448s1.
Transfection of siRNA and plasmidsNeuro-2a cells were cultured at 30% confluence and transfected with 100 pmol/l target-specific or scrambled control siRNA (50 nmol/l) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. The siRNAs used were from Applied Biosystems (siARF6-1: sense AUCUGACAUUUGACACGAATT, antisense UUCGUGUCAAUGUGAGAUCA; siARF6-2: sense GCAAGACAACGAUCCUGUATT, antisense UACAGGAUCGUUGUCUUGCCG).Plasmids for ARF6-cyan fluorescent protein (CFP), T27N ARF6-CFP and Q67L ARF6-CFP were purchased from Addgene (Cambridge, MA). Neuro-2a cells were transfected with plasmids at 70–80% confluence using jetPRIME (Polyplus-transfection, Illkirch, France) according to the manufacturer's instruction. Transfection efficiency (determined by CFP by using fluorescent microscopy) was around 50%.
Lipid analysisLipids were extracted from Neuro-2a cells using the Folch procedure. Heptadecanoyl (C17:0)-containing internal standards of phosphatidylcholine, sphingomyelin, and ceramide and dodecanoyl (C12:0)-containing glucosylceramide were added during the extraction.
The extract was evaporated using nitrogen, reconstituted in chloroform∶methanol (2∶1) and stored at −20°C until further analysis.Phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine and sphingomyelin were quantified as described using direct infusion on a QTRAP 5500® mass spectrometer (ABSciex, Toronto, Canada) equipped with the chip-based nanoESI source TriVersa NanoMate (Advion Biosciences, Ithaca, NJ). Mass spectrometry data files were processed using Lipid Profiler™.
The lipids were quantified using their respective internal standard and normalized against the cellular protein content.Ceramide and glucosylceramide were analyzed using straight-phase HPLC coupled to a Quattro Premier XE triple quadrupole mass spectrometer (Waters, Milford, MA). The lipids were separated using a Sunfire 150×2.1 silica column with 3 µm particles (Waters).
The mobile phase A was isohexane∶isopropanol (95∶5) and the mobile phase B was isohexane∶isopropanol:50 mmol/l ammonium formate in water (25∶65∶10). The gradient went from 100% A (held for 1 min) to 100% B in 5 min. After 4 min at 100% B, the gradient returned to 100% A and the column was equilibrated for 3 min. Thus, the total runtime was 13 min. The flow rate was 500 µl/min. A postcolumn flow of methanol∶isopropanol (1∶1) at 100 µl/min was used to ensure optimal ionization of the lipids in the ion source. Samples were injected in mobile phase A.
Ceramide and glucosylceramide were detected using multiple reaction monitoring, quantified using external standards and normalized against their respective internal standard and the cellular protein content. Glucosylceramide synthase activityThe activity of glucosylceramide synthase was measured by following the conversion of fluorescently labeled ceramide 6- N-7-nitrobenz-2-oxa-1,3-diazol-4-yl aminocaproyl-sphingosine (NBD C6-ceramide) to NBD C6-glucosylceramide in cells, as described,. In brief, cells were washed three times with Hank's balanced salt solution (GIBCO, Invitrogen, Carlsbad, CA) and then incubated with 5 µmol/l NBD C6-ceramides with 5 µmol/l BSA at 4°C for 3 h.
The cells were harvested and the lipids were extracted using chloroform∶methanol 2∶1. The lipids were separated by thin layer chromatography (TLC) (chloroform∶methanol∶ammonium 65∶35∶5) and the fluorescent NBD-glucosylceramide was measured and quantified using fluorescent image acquisition system Fusion FX7 (Peqlab, Sarisbury Green, UK). ARF6 knockdown stimulates differentiation of Neuro-2a cellsIt has previously been observed that inactivation of ARF6 by overexpression of a GAP or a dominant-negative ARF6 promotes neuron differentiation, as shown by increased neuronal outgrowth, in various neuronal cell systems,. Furthermore, activation of ARF6 by expression of the dominant-active ARF6-Q67L decreases the neuronal outgrowth,.In this study, we used Neuro-2a neuronal cells and knocked down ARF6 with siRNA to study the effects on neuron differentiation. We found that 48 hours after transfection with ARF6 siRNA, ARF6 protein was almost totally abolished and ARF6-deficient cells displayed significantly increased neuronal outgrowth.
In addition, the mRNA expression of the differentiation marker NeuroD1, which has been shown to be increased following neuronal differentiation, was upregulated. In agreement with previous reports, overexpression of mutant constructs in Neuro-2a cells confirmed that inactivation of ARF6 (T27N-ARF6) increased neuronal outgrowth and activation of ARF6 (Q67L-ARF6) decreased neuronal outgrowth in our model system. Our results show that ARF6 inactivation using siRNA in Neuro-2a cells is a valid cellular system to investigate ARF6-dependent neuron differentiation and that it is as effective as using dominant negative constructs.
Thus, we can avoid using plasmid constructs for the lipidomics analysis since we have previously experienced that overexpression using DNA plasmids may cause an inflammatory response and thereby affect the lipidome (data not shown). ARF6 is important for the differentiation of Neuro-2a cells.( A–D) Neuro-2a cells were transfected with control (c) or ARF6 siRNA in medium with 10% FCS and analyzed after 48 h. ( A) ARF6 protein levels in cell lysate after siRNA treatment. ( B) Representative micrographs showing neuronal outgrowth from Neuro-2a cells after knockdown of ARF6 using siRNA.
Bar size, 40 µm. ( C) Quantification of neuronal outgrowth from Neuro-2a cells after knockdown of ARF6 using siRNA.
( D) mRNA expression of differentiation markers NeuroD1 and Rbfox3 in RNA extracted from Neuro-2a cells ( n = 2 for control and n = 6, 3 combined siRNAs,. P. ARF6 knockdown increases glucosylceramide levels and decreases sphingomyelin levels in Neuro-2a cellsTo investigate whether ARF6 knockdown affects the lipid composition of Neuro-2a cells, we performed a lipidomics analysis of Neuro-2a cells transfected with control or ARF6 siRNA.
Interestingly, we showed that ARF6 knockdown resulted in significantly increased levels of glucosylceramide and significantly decreased levels of sphingomyelin but did not change ceramide levels. Levels of phosphatidylcholine, phosphatidylethanolamine and phosphatidylserine were unaltered by ARF6 knockdown. ARF6 knockdown increases glucosylceramide levels and decreases sphingomyelin levels in Neuro-2a cells.Neuro-2a cells were transfected with control (c) or ARF6 siRNA in medium with 10% FCS and lipids were extracted after 48 h. ( A) Cellular levels of ceramides (Cer), sphingomyelin (SM) and glucosylceramide (GC) and ( B) phosphatidylcholine (PC), phosphatidylethanolamine (PE) and phosphatidylserine (PS) were analyzed as described in the methods section. N = 4 per group,.
P. ARF6 knockdown increases glucosylceramide synthase mRNA and activityGlucosylceramide and sphingomyelin are synthesized from ceramide in the Golgi apparatus ,.
Because ceramide levels were unchanged by ARF6 knockdown, we speculated that the shift in the relative levels of sphingomyelin and glucosylceramide could be caused by an effect of ARF6 knockdown on glucosylceramide synthase. In agreement with our hypothesis, we observed significantly increased mRNA expression of glucosylceramide synthase in Neuro-2a cells transfected with ARF6 siRNA. In addition, we tested whether glucosylceramide synthase activity was affected by ARF6 knockdown by following the synthesis of glucosylceramide from fluorescently labeled NBD-C6-ceramide.
Importantly, we found that glucosylceramide synthase activity was increased by 80–100% after ARF6 knockdown. ARF6 knockdown increases cellular glucosylceramide levels through increased glucosylceramide synthase activity in Neuro-2a cells.( A) Schematic overview of the sphingolipid synthesis pathway. ( B–D) Neuro-2a cells were transfected with control (c) or ARF6 siRNA in medium with 10% FCS and analyzed after 48 h. ( B) mRNA expression of glucosylceramide synthase (GCS) in RNA extracted from Neuro-2a cells ( n = 6 per group).
( C) Representative image of a TLC plate from a GCS activity assay showing increased levels of synthesized NBD-glucosylceramide in Neuro-2a cells transfected with ARF6 siRNA. ( D) Quantification of increased glucosylceramide synthase activity after ARF6 knockdown ( n = 4 per group). ARF6 regulates neuron differentiation through glucosylceramide synthase activityFinally, we tested if ARF6 regulates differentiation of Neuro-2a cells through an effect on glucosylceramide synthase. We knocked down ARF6 for 48 h to stimulate neuronal outgrowth and then incubated the cells in the presence or absence of the glucosylceramide synthase inhibitor D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propanol (D-PDMP) for 20 h. As expected, the number of cells with long outgrowths increased significantly following ARF6 knockdown. Interestingly, this increased neuronal outgrowth was normalized after incubation with D-PDMP.
Lipid analysis revealed that D-PDMP almost totally abolished glucosylceramide accumulation in Neuro-2a cells as expected. In contrast, ceramide and sphingomyelin levels increased after D-PDMP treatment.
Our results clearly indicate that ARF6 regulates neuronal differentiation through effects on glucosylceramide synthase activity. ARF6-dependent neuronal differentiation is normalized after inhibition of glucosylceramide synthase.( A) Quantification of long outgrowth from Neuro-2a cells transfected with control or ARF6 siRNA in medium with 10% FCS for 48 h and then differentiated for 24 h in medium without serum in the absence or presence of D-PDMP (10 µmol/l). N = 4 per group,. P.
References. 1.Yap CC, Winckler B (2012) Harnessing the power of the endosome to regulate neural development. Neuron 74: 440–451.
2.Donaldson JG, Jackson CL (2011) ARF family G proteins and their regulators: roles in membrane transport, development and disease. Nature Reviews Molecular Cell Biology 12: 362–375. 3.D'Souza-Schorey C, Li G, Colombo MI, Stahl PD (1995) A regulatory role for ARF6 in receptor-mediated endocytosis.
Science 267: 1175–1178. 4.Albertinazzi C, Za L, Paris S, de Curtis I (2003) ADP-ribosylation factor 6 and a functional PIX/p95-APP1 complex are required for Rac1B-mediated neurite outgrowth. Molecular Biology of the Cell 14: 1295–1307. 5.Choi S, Ko J, Lee JR, Lee HW, Kim K, et al. (2006) ARF6 and EFA6A regulate the development and maintenance of dendritic spines.
The Journal of Neuroscience: the official journal of the Society for Neuroscience 26: 4811–4819. 6.Hernandez-Deviez DJ, Casanova JE, Wilson JM (2002) Regulation of dendritic development by the ARF exchange factor ARNO. Nature Neuroscience 5: 623–624.
7.Jaworski J (2007) ARF6 in the nervous system. European Journal of Cell Biology 86: 513–524. 8.Miyazaki H, Yamazaki M, Watanabe H, Maehama T, Yokozeki T, et al.
(2005) The small GTPase ADP-ribosylation factor 6 negatively regulates dendritic spine formation. FEBS letters 579: 6834–6838. 9.Eva R, Crisp S, Marland JR, Norman JC, Kanamarlapudi V, et al. (2012) ARF6 directs axon transport and traffic of integrins and regulates axon growth in adult DRG neurons. The Journal of Neuroscience: the official journal of the Society for Neuroscience 32: 4. 10.Hernandez-Deviez D, Mackay-Sim A, Wilson JM (2007) A Role for ARF6 and ARNO in the regulation of endosomal dynamics in neurons.
Traffic 8: 1750–1764. 11.Bairstow SF, Ling K, Su X, Firestone AJ, Carbonara C, et al. (2006) Type Igamma661 phosphatidylinositol phosphate kinase directly interacts with AP2 and regulates endocytosis.
The Journal of Biological Chemistry 281: 2. 12.Di Paolo G, De Camilli P (2006) Phosphoinositides in cell regulation and membrane dynamics. Nature 443: 651–657. 13.Schweitzer JK, Pietrini SD, D'Souza-Schorey C (2009) ARF6-mediated endosome recycling reverses lipid accumulation defects in Niemann-Pick Type C disease.
PloS One 4: e5193. 14.Folch J, Lees M, Sloane Stanley GH (1957) A simple method for the isolation and purification of total lipides from animal tissues. The Journal of Biological Chemistry 226: 497–509. 15.Ekroos K, Chernushevich IV, Simons K, Shevchenko A (2002) Quantitative profiling of phospholipids by multiple precursor ion scanning on a hybrid quadrupole time-of-flight mass spectrometer. Analytical Chemistry 74: 941–949. 16.Ejsing CS, Duchoslav E, Sampaio J, Simons K, Bonner R, et al.
(2006) Automated identification and quantification of glycerophospholipid molecular species by multiple precursor ion scanning. Analytical Chemistry 78: 6202–6214. 17.van Helvoort A, van't Hof W, Ritsema T, Sandra A, van Meer G (1994) Conversion of diacylglycerol to phosphatidylcholine on the basolateral surface of epithelial (Madin-Darby canine kidney) cells. Evidence for the reverse action of a sphingomyelin synthase.
The Journal of Biological Chemistry 269: 1763–1769. 18.van't Hof W, Silvius J, Wieland F, van Meer G (1992) Epithelial sphingolipid sorting allows for extensive variation of the fatty acyl chain and the sphingosine backbone. The Biochemical Journal 283 (Pt 3)913–917. 19.Hernandez-Deviez DJ, Roth MG, Casanova JE, Wilson JM (2004) ARNO and ARF6 regulate axonal elongation and branching through downstream activation of phosphatidylinositol 4-phosphate 5-kinase alpha.
Molecular biology of the Cell 15: 111–120. 20.Lee JH, Jang S, Jeong HS, Park JS (2011) Effects of sphingosine-1-phosphate on neural differentiation and neurite outgrowth in neuroblastoma cells. Chonnam Med J 47: 27–30. 21.Mutoh T, Tokuda A, Inokuchi J, Kuriyama M (1998) Glucosylceramide synthase inhibitor inhibits the action of nerve growth factor in PC12 cells.
The Journal of Biological Chemistry 273: 7. 22.Uemura K, Taketomi T (1995) Inhibition of neurite outgrowth in murine neuroblastoma NS-20Y cells by calmodulin inhibitors. Journal of Biochemistry 118: 371–375.
23.Wu G, Nakamura K, Ledeen RW (1994) Inhibition of neurite outgrowth of neuroblastoma Neuro-2a cells by cholera toxin B-subunit and anti-GM1 antibody. Molecular and chemical neuropathology/sponsored by the International Society for Neurochemistry and the World Federation of Neurology and research groups on neurochemistry and cerebrospinal fluid 21: 259–271.
24.Ledeen R, Wu G (2011) New findings on nuclear gangliosides: overview on metabolism and function. Journal of Neurochemistry 116: 714–720. 25.Yu RK, Nakatani Y, Yanagisawa M (2009) The role of glycosphingolipid metabolism in the developing brain. Journal of Lipid Research 50 Suppl: S440–445. 26.Halter D, Neumann S, van Dijk SM, Wolthoorn J, de Maziere AM, et al. (2007) Pre- and post-Golgi translocation of glucosylceramide in glycosphingolipid synthesis. The Journal of Cell Biology 179: 101–115.
27.Ichikawa S, Hirabayashi Y (1998) Glucosylceramide synthase and glycosphingolipid synthesis. Trends in Cell Biology 8: 198–202.
Enter your Office 2010 product key. You will be given the choice to download the software or order a DVD copy for a fee. Once the software is. Crack download bandicam. Today i would tell you about EZ Activator Office 2010. Microsoft Toolkit 2.6.6 Windows and Office Activator Download Microsoft Visual Studio, Download. Microsoft Mathematics provides a graphing calculator that plots in 2D and 3D, step-by-step equation solving, and useful tools to help students.
28.Uemura K, Sugiyama E, Taketomi T (1991) Effects of an inhibitor of glucosylceramide synthase on glycosphingolipid synthesis and neurite outgrowth in murine neuroblastoma cell lines. Journal of Biochemistry 110: 96–102. 29.Yanagisawa M, Nakamura K, Taga T (2005) Glycosphingolipid synthesis inhibitor represses cytokine-induced activation of the Ras-MAPK pathway in embryonic neural precursor cells.
Journal of Biochemistry 138: 285–291.
High field asymmetric waveform ion mobility spectrometry (FAIMS), also known as differential ion mobility spectrometry, coupled with liquid chromatography tandem mass spectrometry (LC-MS/MS) offers benefits for the analysis of complex proteomics samples. Advantages include increased dynamic range, increased signal-to-noise, and reduced interference from ions of similar m/z. FAIMS also separates isomers and positional variants. An alternative, and more established, method of reducing sample complexity is prefractionation by use of strong cation exchange chromatography.
Here, we have compared SCX-LC-MS/MS with LC-FAIMS-MS/MS for the identification of peptides and proteins from whole cell lysates from the breast carcinoma SUM52 cell line. Two FAIMS approaches are considered: (1) multiple compensation voltages within a single LC-MS/MS analysis (internal stepping) and (2) repeat LC-MS/MS analyses at different and fixed compensation voltages (external stepping). We also consider the consequence of the fragmentation method (electron transfer dissociation or collision-induced dissociation) on the workflow performance. The external stepping approach resulted in a greater number of protein and peptide identifications than the internal stepping approach for both ETD and CID MS/MS, suggesting that this should be the method of choice for FAIMS proteomics experiments. The overlap in protein identifications from the SCX method and the external FAIMS method was 25% for both ETD and CID, and for peptides was less than 20%.
The lack of overlap between FAIMS and SCX highlights the complementarity of the two techniques. Charge state analysis of the peptide assignments showed that the FAIMS approach identified a much greater proportion of triply-charged ions. High field asymmetric waveform ion mobility spectrometry (FAIMS), also known as differential ion mobility spectrometry, coupled with liquid chromatography tandem mass spectrometry (LC-MS/MS) offers benefits for the analysis of complex proteomics samples. Advantages include increased dynamic range, increased signal-to-noise, and reduced interference from ions of similar m/ z.
FAIMS also separates isomers and positional variants. An alternative, and more established, method of reducing sample complexity is prefractionation by use of strong cation exchange chromatography. Here, we have compared SCX-LC-MS/MS with LC-FAIMS-MS/MS for the identification of peptides and proteins from whole cell lysates from the breast carcinoma SUM52 cell line. Two FAIMS approaches are considered: (1) multiple compensation voltages within a single LC-MS/MS analysis (internal stepping) and (2) repeat LC-MS/MS analyses at different and fixed compensation voltages (external stepping). We also consider the consequence of the fragmentation method (electron transfer dissociation or collision-induced dissociation) on the workflow performance. The external stepping approach resulted in a greater number of protein and peptide identifications than the internal stepping approach for both ETD and CID MS/MS, suggesting that this should be the method of choice for FAIMS proteomics experiments.
The overlap in protein identifications from the SCX method and the external FAIMS method was 25% for both ETD and CID, and for peptides was less than 20%. The lack of overlap between FAIMS and SCX highlights the complementarity of the two techniques. Charge state analysis of the peptide assignments showed that the FAIMS approach identified a much greater proportion of triply-charged ions. IntroductionRecent work by Mann and coworkers revealed that while 100,000 detectable peptides were present in a typical proteomics liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis, only 16% were actually selected for fragmentation. They found the greatest constraint to be precursor ion isolation: just 14% of the ion current in the isolation window derived from the precursor ion.
That is, co-fragmentation of peptides would occur in virtually all cases. A further challenge for comprehensive proteome coverage is the dynamic range ,. These limitations can be addressed to some extent by prefractionation of the sample, for example, by gel electrophoresis or by strong cation exchange chromatography ,. Nevertheless, prefractionation is associated with additional sample clean-up steps and inevitable sample loss.High field asymmetric waveform ion mobility spectrometry (FAIMS), or differential ion mobility, coupled with LC MS/MS has the potential to circumvent the restrictions of prefractionation.
FAIMS separates gas-phase ions at atmospheric pressure on the basis of differences in their ion mobility in high and low electric fields ,. FAIMS coupled with electrospray ionization has shown advantages for peptide analysis by reducing chemical noise and improving signal-to-noise –, and enabling the separation of localization isomers and sequence variants –. demonstrated the benefits of FAIMS for proteomics by comparing LC collision-induced dissociation (CID) MS/MS with LC FAIMS CID MS/MS for the analysis of tryptic digests of simple protein mixtures and whole cell lysates from human U937 monocytic cells. The results showed a 10-fold improvement in limits of detection with a corresponding increase of 55% in the number of assigned MS/MS spectra (i.e., protein identification and sequence coverage were significantly improved as a result of implementation of FAIMS in the proteomics workflow). More recent work from that laboratory applied LC FAIMS MS/MS to the analysis of the Drosophila melanogaster phosphoproteome, again resulting in a 50% increase in peptide identifications. Swearingen et al.
have also shown that incorporation of FAIMS in the workflow improves proteome coverage. Using a modified electrospray source, they observed an increase of 50% in peptide identifications and 64% in protein identifications compared with LC MS/MS.In a FAIMS analysis, ions are transported by a carrier gas between two electrodes to which an asymmetric waveform is applied. As a consequence of their differential ion mobility, the ions travel a greater distance towards one electrode than the other, and will eventually collide with the electrode. To prevent that occurrence, a compensation voltage (CV) is applied to one electrode. By scanning the compensation voltage, it is possible to selectively transmit ions through the FAIMS device. In terms of a proteomic analysis, there are two possible approaches for CV scanning: the CV may be scanned within the LC MS/MS analysis as described by Thibault and co-workers and referred to herein as “internal CV stepping,” or each LC MS/MS analysis is performed at a fixed CV with multiple analyses at different CVs, as described by Swearingen et al.
and referred to herein as “external CV stepping.” We have evaluated the two approaches by comparing the results obtained from analyses of whole cell lysates from human SUM52 cells. Our results show that the external CV stepping method results in greater proteome coverage.
In addition, we have compared the gas-phase fractionation afforded by FAIMS with prefractionation by strong cation exchange (SCX) chromatography. Our findings support those of Bridon et al. in their comparison of 2D SCX-LC MS/MS with the internal stepping method for the analysis of phosphopeptides. Finally, we have considered the relationship between fragmentation method and FAIMS, in terms of proteome coverage obtained.
Replicate analyses were performed in which either CID or electron transfer dissociation (ETD) was the fragmentation method. That approach avoids any bias that may be inherent in a decision tree method in which ETD or CID is triggered depending on the precursor ion m/ z and charge. SUM52 Cell CultureSUM52 breast cancer carcinoma cells were cultured in HPMi-1640 formulation, supplemented with 2 mM L-glutamine, 1% Pen-Strep and 10% PBS at 37 °C in a 5% CO 2 atmosphere.
When confluent, cells were washed in PBS twice and lysis buffer added on ice for 30 min. Lysis buffer contained Triton X-100 (0.5%), NaCl (0.15 M), PhosphoStop phosphatase inhibitor tablet (Roche, Indianapolis, IN, USA) and Mini-Complete protease inhibitor (Roche). The lysed cells were removed from the flask with a cell scrapper. Total protein concentrations of the cleared lysates were then determined by Coomassie (Bradford) Protein Assay kit (Pierce, Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer’s instructions. Strong Cation Exchange (SCX) ChromatographyDesalted and dried peptides from 200 μg of lysate (as measured prior to digestion) were resuspended in 100 μL mobile phase A (10 mM KH 3PO 4, 25% acetonitrile, pH 3) and loaded onto a 100 × 2.1 mm polysulfoethyl A column (5 μm particle size, 20 nm pore size, PolyLC, Columbia, MD, USA) at a flow rate of 200 μL/min.
Peptides were separated with a gradient from 0%–50% mobile phase B (10 mM KH 3PO 4, 25% acetonitrile, 500 mM KCl, pH 3) over 40 min, increasing to 70% B over 5 min before returning to 100% A. Fifteen fractions were collected over 54 min. Fractions were combined as follows: 1, 14 and 15, 2, 12 and 13, 3, 10 and 11, 4 and 9, 5 and 8, 6 and 7 for a total of 6 fractions. The combined fractions were desalted as above. Liquid ChromatographyPeptides (1.66 μg) were loaded onto a 150 mm Acclaim PepMap100 C18 column (LC Packings, Sunnyvale, CA, USA) in mobile phase A (0.1% formic acid; JT Baker, Holland Sigma Aldrich, Deventer, Holland). Peptides were separated over a linear gradient from 3.2% to 44% mobile phase B (acetonitrile + 0.1% formic acid, JT Baker, Sigma Aldrich, Deventer, Holland) with a flow rate of 350 nL/min.
The column was then washed with 90% mobile phase B before re-equilibrating at 3.2% mobile phase B. The column oven was heated to 35 °C. For standard (non-FAIMS) LC-MS/MS the LC system was coupled to an Advion Triversa Nanomate (Advion, Ithaca, NY, USA), which infused the peptides with a spray voltage of 1.7 kV. In FAIMS analyses, the LC system was coupled to an ADPC-IMS PicoFrit nano-ESI probe (New Objective, Woburn, MA, USA). The spray voltage was 2.95 kV. Peptides were infused directly into the LTQ-Orbitrap Velos ETD (Thermo Fischer Scientific, Bremen, Germany). Tandem Mass Spectrometry MS/MSETD The mass spectrometer performed a full FT-MS scan ( m/ z 380–1600) and subsequent ETD MS/MS scans of the three most abundant ions above a threshold of 1000.
To facilitate CV scanning in the internal stepping method, and to ensure consistency between methods, a top 3 method was utilized. Survey scans were acquired in the Orbitrap with a resolution of 15,000 at m/ z 400. Precursor ions were subjected to supplemental activation (sa) ETD in the linear ion trap. Width of the precursor isolation window was 3 m/ z and only multiply charged precursor ions were subjected to saETD. SaETD was performed with fluoranthene ions.
Automatic gain control (AGC) was used to accumulate sufficient ions (fluoranthene, target 1 × 10 5, maximum fill time 50 ms. Precursor ions, target 5 × 10 4, maximum fill time 100 ms) precursor ions were activated for 100 ms (charge dependent activation time was enabled). Dynamic exclusion repeat count was set to 1 with duration of 60 s. Data acquisition was controlled by Xcalibur 2.1 (Thermo Fisher Scientific). The mass exclusion window was m/ z ±0.05 and the exclusion list was set to 500.CID The mass spectrometer performed a full FT-MS scan ( m/ z 380–1600) and subsequent CID MS/MS scans of the three most abundant ions above a threshold of 1000.
To facilitate CV scanning in the internal stepping method, and to ensure consistency between methods, a top 3 method was utilized. Survey scans were acquired in the Orbitrap with a resolution of 15,000 at m/ z 400.
CID was performed in the linear ion trap with helium gas at a normalized collision energy of 35% (target 5 × 10 4, maximum fill time 100 ms). CID activation was performed for 10 ms. Width of the precursor isolation window was 2 m/ z and only multiply charged precursor ions were subjected to CID. The mass exclusion window was m/ z ±0.05 and the exclusion list was set to 500. LC-FAIMS MS/MS AnalysisFAIMS settings were: dispersion voltage (DV) -5000 V, gas flow 2.75 L/min, gas composition 50/50 He/N, inner electrode 70 °C, outer electrode 90 °C. The dwell time was set at 50 ms.Internal CV Stepping The mass spectrometer performed a full FT-MS scan ( m/ z 380–1600, resolution 15,000) at compensation voltage (CV) of −25 V and subsequent CID or ETD MS/MS events of the three most abundant ions (MS/MS parameters as described above) at the same CV value. The sequence was repeated for CVs of −30 V, –35 V, –40 V, –45 V, and −50 V, before cycling back to CV = −25 V.
Replicate ( n = 6) analyses were performed.External CV Stepping The mass spectrometer performed a full FT-MS scan and subsequent MS/MS of the three most abundant ions (MS/MS parameters as described above). Six analyses were performed and for each the CV remained constant throughout (CV = −25, –30, –35, –40, –45, and −50 V).
Database Search ParametersAll data were searched against IPI Human database (V 3.81) containing common contaminants and concatenated with a reverse database (184746 sequences). The data were searched using both the SEQUEST and Mascot algorithms (controlled through Proteome Discoverer ver. 1.2, mascot ver. In both SEQUEST and Mascot searches, the following parameters were used: no spectral grouping; total intensity threshold, 0; minimum peak count, 1; precursor ion m/ z tolerance, ±5 ppm; fragment ion m/ z tolerance, ±0.5 Da; fully tryptic, 2 missed cleavages allowed; Cys carboxyamidomethylation was set as a fixed modification; N-terminal acetylation, deamidation of Asn and Gln, oxidation of Met, and phosphorylation of Ser, Thr, and Tyr were set as variable modifications. Product ion types for CID data were b and y, for ETD c, y, and z ions were accepted. Data were filtered to a protein FDR of 1% (peptide FDR was also 1% or lower) using the Discoverer software (Exp values and XCorr values for filter are detailed in Supplemental Table ). Protein and peptide false discovery rates were calculated by dividing number of reverse hits by the total number of proteins/peptides identified.
Protein grouping was performed by the Proteome Discoverer software. One peptide was required for a positive protein identification. ResultsWhole cell lysates (WCL) from SUM52 cells were digested with trypsin.
Equal amounts (30 μg) of the digest were analyzed by one of three proteomic workflows: (1) on-line reversed-phase liquid chromatography FAIMS MS/MS in which the compensation voltage remained constant for the entire analysis. Analyses were performed at CVs of −25, –30, –35, –40, –45, and –50 V, for a total of six analyses (5 μg each). We refer to this method as “external CV stepping;” (2) on-line reversed-phase liquid chromatography FAIMS MS/MS in which the compensation voltage was cycled (CV = −25, –30, –35, –40, –45, and –50 V) during the analysis. Six repeats were performed. We refer to this method as “internal CV stepping;” (The CV values were selected in order to both maximize peptide ion transmission and minimize duty cycle. Preliminary direct infusion FAIMS experiments (data not shown) on a set of 15 tryptic peptides from alcohol dehydrogenase, cytochrome c, and bovine serum albumin suggest that the majority of 2+ and 3+ peptide ions are transmitted over this CV range); (3) the digest was separated by strong cation exchange chromatography (SCX) and 6 fractions collected.
Each fraction was subjected to on-line reversed-phase liquid chromatography MS/MS. Each workflow was repeated for CID MS/MS and ETD MS/MS. Each experiment required 6 hours of instrument time (6 LC MS/MS runs), resulting in 36 hours of instrument time. The data were searched against the human IPI database, ver.
3.81 (concatenated with reversed entries) using both the Mascot and SEQUEST algorithms and filtered to give a 1% false discovery rate. The database results were combined and redundancy removed. LC-ETD-MS/MSThe number of proteins identified from the three workflows is summarized in Figure (top). A total of 407 proteins were identified by external CV stepping, 302 by internal CV stepping and 463 by the SCX method (see Supplemental Table for proteins identified).
Sixty percent of the proteins identified by internal CV stepping were also identified by external CV stepping, and 44% were also identified by the SCX method. Figure (middle) summarizes the proteins identified by external CV stepping and the SCX method. Only 22% of the total proteins identified are identified by both methods.
That result demonstrates the complementarity of SCX-based 2D-LC-MS/MS analysis and LC-FAIMS-MS/MS analysis. To probe the origin of this complementarity, we analyzed the protein identifications in terms of the number of non-redundant peptide assignments. Figure, bottom, shows that the majority of the proteins identified by external CV stepping only (74%) were identified by a single peptide (left histogram). The same is true for those identified by the SCX method alone (58%, right histogram). The proteins identified by both methods had a higher proportion of multiple peptide assignments (45% for external CV stepping and 61% for the SCX method, middle histogram). These findings may indicate that those proteins identified by both methods are more abundant and, therefore, their peptides are more likely to be selected for MS/MS and produce higher quality spectra. It is also possible that the proteins identified by both methods may be identified by different peptides and that the orthogonality between the two methods may be even greater at the peptide level.
Analysis of the peptides responsible for the assignments of the proteins identified by both methods reveals that 27% were unique to the external stepping analyses and 44% to the SCX analyses. Top: peptide identifications resulting from ETD MS/MS with the external CV stepping ( pink) and SCX methods ( blue). Peptides with identical sequence but differing charge states are treated as unique assignments; middle: charge state analysis of peptides identified by external CV stepping only ( right), SCX method only ( left) and both methods ( centre) (blue = 2+, red = 3+, green = 4+, purple = 5+, and yellow = 6+); bottom: non-redundant peptide identifications resulting from LC FAIMS ETD MS/MS with external CV stepping ( pink), internal CV stepping ( green), and LC ETD MS/MS with SCX prefractionation ( blue). LC-CID-MS/MS AnalysisFigure (top) summarizes the proteins identified by CID MS/MS for the three workflows (see also Supplemental Table ). A total of 783 proteins were identified by external CV stepping, 311 by internal CV stepping, and 919 by the SCX method. There is greater overlap in the proteins identified by each of the workflows than was observed for the ETD data. Of the proteins identified via internal CV stepping, 69% were also identified via external CV stepping and 54% were also identified via the SCX method.
Figure (middle) compares the proteins identified by external CV stepping and the SCX method; 28% of the total proteins identified were identified by both methods. The proteins identified were analyzed in terms of the number of peptide assignments (Figure, bottom). As seen for the ETD data, the majority of the proteins unique to a particular workflow were identified by a single peptide: 63% of those proteins identified by external CV stepping alone and 64% of those identified solely by the SCX method; 65% and 66% of those proteins identified by both methods (external CV stepping and SCX prefractionation, respectively) had 2 or more peptide assignments. Of the peptide assignments for the proteins identified by both methods, 36% were unique to the external CV stepping method and 25% were unique to the SCX prefractionation method. Top: protein identifications resulting from LC FAIMS CID MS/MS with external CV stepping ( pink), internal CV stepping ( green), and LC CID MS/MS with SCX prefractionation ( blue); middle: protein identifications resulting from external CV stepping ( pink) and SCX prefractionation ( blue); bottom: number of peptides identified per protein for each of the sections of Figure 3 middle (external CV stepping only, both external CV stepping and SCX prefractionation, SCX prefractionation only)The number of peptides identified by external CV stepping and the SCX methods is summarized in Figure (top). As in the ETD analysis, peptides with identical sequence but differing charge state are treated as unique assignments.
Advion Triversa Nanomate Manual High School Denver
Thirty-eight percent of the peptides were identified by external CV stepping alone and 42% by the SCX method alone. The overlap in peptide identifications between the two methods is 20% of the total peptides identified. The peptide identifications were analyzed for distribution of charge states (Figure, middle).
As seen for the ETD data, external CV stepping resulted in a higher percentage of 3+ peptide identifications than the SCX method (38% versus 24%); however, external CV stepping with CID resulted in fewer 3+ identifications than with ETD (see Figure, middle). Figure (bottom) shows the non-redundant peptide identifications obtained via the three workflows (see Supplemental Table ). The overlap between the peptides identified by both external CV stepping and internal CV stepping is high: 83% of the “internal” identifications were also “external” identifications. Top: Peptide identifications resulting from CID MS/MS with the external CV stepping ( pink) and SCX methods ( blue). Peptides with identical sequence but differing charge states are treated as unique assignments; middle: charge state analysis of peptides identified by external CV stepping only ( right), SCX method only ( left), and both methods ( center) (blue = 2+, red = 3+, green = 4+, and purple = 5+); bottom: non-redundant peptide Identifications resulting from LC FAIMS CID MS/MS with external CV stepping ( pink), internal CV stepping ( green), and LC CID MS/MS with SCX prefractionation ( blue).
DiscussionThe results clearly demonstrate that coupling of FAIMS, and particularly using an external CV stepping method, with LC MS/MS extends proteome coverage. This finding is in agreement with the findings of Swearingen et al. , who compared external CV stepping with repeat reversed-phase LC MS/MS injections of the same sample. In the ETD dataset, use of external CV stepping resulted in identification of 252 additional proteins (i.e., an increase of 54% over those identified by SCX LC ETD MS/MS. At the peptide level, external CV stepping generated 516 additional peptide assignments, an increase of 33%. In the CID dataset, external CV stepping gave 406 additional proteins and 1402 additional peptides, i.e., 44% and 60% increases over SCX LC CID MS/MS alone. Overall, the number of identifications is quite low.
Triversa Nanomate
It is possible that by using a longer LC gradient or by increasing the number of MS/MS events per survey scan (e.g., by use of a top 7 or top 20 method) more identifications might be made. The latter possibility would not be suitable for the internal stepping method because the time for the CV cycle needs to be kept to a minimum. For the FAIMS analyses, use of a source such as that described by Swearingen et al. should improve the number of identifications.CID outperformed ETD in terms of number of identifications and there are two possible explanations for this observation. First, the protein database search algorithms were originally designed for CID data and, consequently, ETD (which produces very different spectra) generally results in lower scores and fewer identifications –. Secondly, trypsin cleaves proteins at Lys and Arg residues meaning that the majority of tryptic peptides favour the 2+ charge state. It is well known that ETD of doubly-charged ions, even with the aid of supplemental activation, produces fewer fragment ions than for higher charge states resulting in lower search scores ,.
Nevertheless, the two fragmentation techniques do provide complementary information: in the external stepping method, a total of 2266 non-redundant peptides were identified, 252 of which were unique to ETD and 1543 unique to CID. For the internal method, 934 non-redundant peptides were identified, 270 unique to ETD and 304 unique to CID.
For the SCX analyses, 492 out of a total of 2646 were unique to ETD and 1365 were unique to CID. Clearly, the number of identifications is increased by incorporating ETD in the workflow.Figures and (middle) show the distribution of charge states of the peptide identifications by the external CV stepping method and the SCX MS/MS methods. There is a notable increase in the proportion of 3+ identifications when ETD is employed, compared with CID. Within the ETD data set, the proportion of 3+ and 2+ identifications by SCX MS/MS is approximately equal (39.9% versus 37.1%) and the overlap in identifications between the two charge states is 32%.
The proportion of 3+ to 2+ identifications by external stepping, however, is approximately threefold (66.7% to 21.7%), with an overlap of 6%. As described above, electrospray of tryptic peptides tends to produce predominantly 2+ ions, with 3+ ions forming a minor component. In a typical LC MS/MS proteomics workflow, the survey scan will reveal both charge states and the more abundant 2+ ions will be selected for fragmentation. FAIMS, however, transmits 2+ and 3+ ions at different compensation voltages, thereby increasing the likelihood that a 3+ ion will be selected for fragmentation at the compensation voltages applied here. This is especially valuable for ETD, which is known to be more efficient for 3+ and higher charge states. It is possible that the CV values used in these experiments lead to underrepresentation of 2+ ions; however, preliminary direct infusion FAIMS data (not shown) from a set of tryptic peptides revealed that 10/11 of the 2+ ions were transmitted between −20 and −35 V, and 3/4 of the 3+ ions were transmitted between −30 and –50 V.External CV stepping resulted in a greater number of identifications than internal CV stepping: 407 versus 302 proteins, and 723 versus 630 non-redundant peptides for ETD; 783 versus 311 proteins, and 2014 versus 664 non-redundant peptides for CID.
This might be expected as internal CV stepping has a much longer duty cycle than external CV stepping: for a particular CV in the internal stepping method, the method will cycle through five other CV values before recording the next survey scan. For many peptides, the top of the LC chromatographic peak for a particular CV will not coincide with mass spectral recording. This will become problematic if, during the survey scan at a particular CV, the ions are not sufficiently abundant to either produce high quality MS/MS spectra or to trigger MS/MS. In the CID analyses, the total numbers of MS/MS events were 13,613 (internal stepping), and 18,195 (external stepping). Conversely, for the ETD analyses, the numbers were 9528 (external stepping) and 10,313 (internal stepping). ETD has a longer duty cycle than CID; the target number of ions for CID is half that for ETD, and the activation time is 10-fold shorter.
In addition, although dynamic exclusion was applied within each analysis, the software is not currently available to apply between analyses and so it was not used between the six repeats of the internal CV stepping analyses. For the CID data, 83% of the peptides identified by internal CV stepping were also identified by external CV stepping; however, for the ETD data, that figure is just 69%. This unexpected observation is explored further below.In order to explore the origin of complementarity between the three workflows, we considered the top five unique peptide assignments obtained from each for both ETD and CID. The findings are summarized in Table. Of the five highest scoring peptides identified by external CV stepping only, three (LKKEDIYAVEIVGGATR 3+, LLKIPVDTYNNILTVLK 3+, VPVITGSFVDLSVELK 3+) were also observed in the internal stepping survey scans (mass error.